Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4579976
End position: 4580011
Length: 36

DNA sequence
>NC_008699, from 4579976 to 4580011 (36 bp); Nocardioides sp. JS614 CGACCGCCACGTCGACCACCACGTCGACCACCACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4579841-4581298	Sequence	Noca_4330 - peptidoglycan binding domain-containing protein