Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4528918
End position: 4528953
Length: 36

DNA sequence
>NC_008699, from 4528918 to 4528953 (36 bp); Nocardioides sp. JS614 CCGGGCTGCCGGCCGGGTTGTCGGCCGGGCGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4528136-4528918	Sequence	Noca_4286 - hypothetical protein
ORF. 4528866-4529483	Sequence	Noca_4287 - N-acetyltransferase GCN5 (Protein is coded in complementary strand; from 4529483 to 4528866)