Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4484643
End position: 4484678
Length: 36

DNA sequence
>NC_008699, from 4484643 to 4484678 (36 bp); Nocardioides sp. JS614 CGTCGGGGCCGCCGTCGAGGCCGCCGTCGGGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4483859-4484809	Sequence	Noca_4246 - dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein (Protein is coded in complementary strand; from 4484809 to 4483859)