Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4398650
End position: 4398685
Length: 36

DNA sequence
>NC_008699, from 4398650 to 4398685 (36 bp); Nocardioides sp. JS614 CGCCGGCCCAGGCGCCGGCCTCGGCGCCCGCCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4398409-4399623	Sequence	Noca_4166 - hypothetical protein (Protein is coded in complementary strand; from 4399623 to 4398409)