Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4344652
End position: 4344687
Length: 36

DNA sequence
>NC_008699, from 4344652 to 4344687 (36 bp); Nocardioides sp. JS614 GGGCTCGACGGAGGGTACGACGGAGGGCTCGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4343969-4344712	Sequence	Noca_4113 - ABC transporter-like protein (Protein is coded in complementary strand; from 4344712 to 4343969)