Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3738595
End position: 3738630
Length: 36

DNA sequence
>NC_008699, from 3738595 to 3738630 (36 bp); Nocardioides sp. JS614 CCACCAGGGCGACCACCAGGGCCGCCACCAGCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3738591-3739193	Sequence	Noca_3527 - hypothetical protein (Protein is coded in complementary strand; from 3739193 to 3738591)