Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3467726
End position: 3467761
Length: 36

DNA sequence
>NC_008699, from 3467726 to 3467761 (36 bp); Nocardioides sp. JS614 GGCATCCCGGCCATCCCGGGCATCCCCGGCATCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3467498-3469069	Sequence	Noca_3266 - signal recognition particle subunit FFH/SRP54 (srp54) (Protein is coded in complementary strand; from 3469069 to 3467498)