Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3279022
End position: 3279057
Length: 36

DNA sequence
>NC_008699, from 3279022 to 3279057 (36 bp); Nocardioides sp. JS614 CGGTGCGCCGTTCGCTGGGCCGTTCGCTGGGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3278322-3279080	Sequence	Noca_3077 - type 11 methyltransferase (Protein is coded in complementary strand; from 3279080 to 3278322)