Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3099628
End position: 3099663
Length: 36

DNA sequence
>NC_008699, from 3099628 to 3099663 (36 bp); Nocardioides sp. JS614 CCGGTCGGGCGGCCGGTCAGGCGACCGGGCGTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3099645-3100475	Sequence	Noca_2918 - thiosulfate sulfurtransferase (Protein is coded in complementary strand; from 3100475 to 3099645)