Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2964502
End position: 2964537
Length: 36

DNA sequence
>NC_008699, from 2964502 to 2964537 (36 bp); Nocardioides sp. JS614 GTCGTGGGCTCGGTGGTGGGCTCGGTACTGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2964100-2965500	Sequence	Noca_2794 - membrane-bound lytic murein transglycosylase B-like protein (Protein is coded in complementary strand; from 2965500 to 2964100)