Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2937105
End position: 2937140
Length: 36

DNA sequence
>NC_008699, from 2937105 to 2937140 (36 bp); Nocardioides sp. JS614 GTCTTCTGCGCGGACTTCTGCACGGACTTCTGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2936514-2937146	Sequence	Noca_2765 - regulatory protein TetR (Protein is coded in complementary strand; from 2937146 to 2936514)