Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2811916
End position: 2811951
Length: 36

DNA sequence
>NC_008699, from 2811916 to 2811951 (36 bp); Nocardioides sp. JS614 TCGCCGTCCGTCACGCCGTCCCTCACGCCGTCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2811457-2811942	Sequence	Noca_2641 - YbaK/prolyl-tRNA synthetase associated domain-containing protein (Protein is coded in complementary strand; from 2811942 to 2811457)
ORF... 2811951-2812577	Sequence	Noca_2642 - type 11 methyltransferase (Protein is coded in complementary strand; from 2812577 to 2811951)