Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2735663
End position: 2735698
Length: 36

DNA sequence
>NC_008699, from 2735663 to 2735698 (36 bp); Nocardioides sp. JS614 CTTGTCGGTTGTCTTGTCGATTGGCTCGTCGGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2735553-2736467	Sequence	Noca_2566 - membrane spanning protein (Protein is coded in complementary strand; from 2736467 to 2735553)