Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2452973
End position: 2453008
Length: 36

DNA sequence
>NC_008699, from 2452973 to 2453008 (36 bp); Nocardioides sp. JS614 GGCTGCTGGGCCTGTTGCTGGGCCTGTTGCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2452196-2453989	Sequence	Noca_2303 - 2-oxoglutarate dehydrogenase E2 component (Protein is coded in complementary strand; from 2453989 to 2452196)