Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2358347
End position: 2358382
Length: 36

DNA sequence
>NC_008699, from 2358347 to 2358382 (36 bp); Nocardioides sp. JS614 CCGCTCAGGTCACCGCTTAGGCCACCGCTCGGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2358320-2358712	Sequence	Noca_2209 - ArsR family transcriptional regulator (Protein is coded in complementary strand; from 2358712 to 2358320)