Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 231781
End position: 231816
Length: 36

DNA sequence
>NC_008699, from 231781 to 231816 (36 bp); Nocardioides sp. JS614 CGGTCACGTCGCTGGTCACGTCGCTGGTCACGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 231042-231788	Sequence	Noca_0215 - ABC transporter-like protein (Protein is coded in complementary strand; from 231788 to 231042)