Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2105817
End position: 2105852
Length: 36

DNA sequence
>NC_008699, from 2105817 to 2105852 (36 bp); Nocardioides sp. JS614 AGCTCCTCGGCCAGCTGCTCGACCAGCTCCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2105763-2108981	Sequence	Noca_1977 - PAS/PAC sensor hybrid histidine kinase (Protein is coded in complementary strand; from 2108981 to 2105763)