Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 193675
End position: 193710
Length: 36

DNA sequence
>NC_008699, from 193675 to 193710 (36 bp); Nocardioides sp. JS614 GGTCACGGCCCGGGTCACGGTCCGGGTCACGGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 193659-194276	Sequence	Noca_0182 - molybdopterin-guanine dinucleotide biosynthesis protein (Protein is coded in complementary strand; from 194276 to 193659)