Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1845207
End position: 1845242
Length: 36

DNA sequence
>NC_008699, from 1845207 to 1845242 (36 bp); Nocardioides sp. JS614 GCGGGCTGCCCGGCGGGCTGCTGGGCGGGCTGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1841727-1845518	Sequence	Noca_1737 kgd alpha-ketoglutarate decarboxylase (Protein is coded in complementary strand; from 1845518 to 1841727)