Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1807838
End position: 1807873
Length: 36

DNA sequence
>NC_008699, from 1807838 to 1807873 (36 bp); Nocardioides sp. JS614 AGGCGGCGCGGAGGGCGGCGCCGAGGGCGGTGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1807710-1809110	Sequence	Noca_1702 - sigma-70 region 2 domain-containing protein (Protein is coded in complementary strand; from 1809110 to 1807710)