Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 178476
End position: 178511
Length: 36

DNA sequence
>NC_008699, from 178476 to 178511 (36 bp); Nocardioides sp. JS614 GTCGCTGCCCTGGTCGCTGGCCTGGTCGCTGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 178261-179376	Sequence	Noca_0164 - adenylyl cyclase class-3/4/guanylyl cyclase (Protein is coded in complementary strand; from 179376 to 178261)