Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1711960
End position: 1711995
Length: 36

DNA sequence
>NC_008699, from 1711960 to 1711995 (36 bp); Nocardioides sp. JS614 CCTCGGCGCCCTCGGCGCCCTCGGCGCCCTCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1711872-1712303	Sequence	Noca_1612 - hypothetical protein (Protein is coded in complementary strand; from 1712303 to 1711872)