Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1294560
End position: 1294595
Length: 36

DNA sequence
>NC_008699, from 1294560 to 1294595 (36 bp); Nocardioides sp. JS614 CGGCAGTCACGCCGGCAGTCACGCCGGCGGTCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1294388-1294606	Sequence	Noca_1221 - hypothetical protein
ORF... 1294591-1295073	Sequence	Noca_1222 - hypothetical protein (Protein is coded in complementary strand; from 1295073 to 1294591)