Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 125037
End position: 125072
Length: 36

DNA sequence
>NC_008699, from 125037 to 125072 (36 bp); Nocardioides sp. JS614 GACCGGCCCAGTGACCGGCCCAGTGGCCTGCCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 124963-125349	Sequence	Noca_0111 - hypothetical protein (Protein is coded in complementary strand; from 125349 to 124963)