Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1113973
End position: 1114008
Length: 36

DNA sequence
>NC_008699, from 1113973 to 1114008 (36 bp); Nocardioides sp. JS614 GGCCCGGTCCATGGCCCGGTCCACTGCCCGCTCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1113257-1114021	Sequence	Noca_1055 - Hly-III family protein (Protein is coded in complementary strand; from 1114021 to 1113257)