Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1070270
End position: 1070305
Length: 36

DNA sequence
>NC_008699, from 1070270 to 1070305 (36 bp); Nocardioides sp. JS614 GCGGGAGTGCGGGCGGAAGTGCGGGCGGAAGTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1070265-1070426	Sequence	Noca_1018 - hypothetical protein (Protein is coded in complementary strand; from 1070426 to 1070265)