Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1015203
End position: 1015238
Length: 36

DNA sequence
>NC_008699, from 1015203 to 1015238 (36 bp); Nocardioides sp. JS614 GTCGTCGGGGTGTCCGTCGGGGTGTCCGTCGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1015173-1015643	Sequence	Noca_0966 - hypothetical protein (Protein is coded in complementary strand; from 1015643 to 1015173)