Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4837017
End position: 4837049
Length: 33

DNA sequence
>NC_008699, from 4837017 to 4837049 (33 bp); Nocardioides sp. JS614 GCCGGGTCGCGAGCGGGTCGCGGCCGGGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4836251-4837690	Sequence	Noca_4569 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 4837690 to 4836251)