Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4687161
End position: 4687193
Length: 33

DNA sequence
>NC_008699, from 4687161 to 4687193 (33 bp); Nocardioides sp. JS614 GCGACCACGCCGTGACCACGCCATGACCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4686340-4687176	Sequence	Noca_4433 - hypothetical protein
ORF... 4687184-4688134	Sequence	Noca_4434 - short-chain dehydrogenase/reductase SDR