Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3957400
End position: 3957432
Length: 33

DNA sequence
>NC_008699, from 3957400 to 3957432 (33 bp); Nocardioides sp. JS614 GGAACCGGCGAGGAACCGGCGAGGAACCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3957163-3957483	Sequence	Noca_3733 - hypothetical protein (Protein is coded in complementary strand; from 3957483 to 3957163)