Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1412146
End position: 1412178
Length: 33

DNA sequence
>NC_008699, from 1412146 to 1412178 (33 bp); Nocardioides sp. JS614 TGGGCGCAGGGCGGGCGCAGGGTGGGCGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1412168-1414216	Sequence	Noca_1340 - PAS/PAC sensor signal transduction histidine kinase