Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1039864
End position: 1039896
Length: 33

DNA sequence
>NC_008699, from 1039864 to 1039896 (33 bp); Nocardioides sp. JS614 TTCGCCCGGTCTCTGCCCGGTCTGTGCCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1039896-1040924	Sequence	Noca_0990 - hypothetical protein (Protein is coded in complementary strand; from 1040924 to 1039896)