Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 657180
End position: 657209
Length: 30

DNA sequence
>NC_008699, from 657180 to 657209 (30 bp); Nocardioides sp. JS614 TCGGTCTGAATCGGCCTGACTCGAGCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 657099-658139	Sequence	Noca_0619 - hypothetical protein (Protein is coded in complementary strand; from 658139 to 657099)