Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3870579
End position: 3870608
Length: 30

DNA sequence
>NC_008699, from 3870579 to 3870608 (30 bp); Nocardioides sp. JS614 GTGGCCGTGGCCGTGCCCGTGGCCGTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3870577-3872202	Sequence	Noca_3646 - chaperonin GroEL (Protein is coded in complementary strand; from 3872202 to 3870577)