Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3744832
End position: 3744861
Length: 30

DNA sequence
>NC_008699, from 3744832 to 3744861 (30 bp); Nocardioides sp. JS614 GGGTCGGGGACGGGTTCGGGGACGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3743754-3744875	Sequence	Noca_3533 - adenosine deaminase (Protein is coded in complementary strand; from 3744875 to 3743754)