Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3727154
End position: 3727183
Length: 30

DNA sequence
>NC_008699, from 3727154 to 3727183 (30 bp); Nocardioides sp. JS614 CGTCCGCCTCCGCCTCCGCGGCCGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3726055-3727308	Sequence	Noca_3515 - SpoIID/LytB domain-containing protein (Protein is coded in complementary strand; from 3727308 to 3726055)