Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3675174
End position: 3675203
Length: 30

DNA sequence
>NC_008699, from 3675174 to 3675203 (30 bp); Nocardioides sp. JS614 CCCAGGTCAGGTCAGGTCAGGTCAGGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3675201-3675608	Sequence	Noca_3466 ndk nucleoside diphosphate kinase (Protein is coded in complementary strand; from 3675608 to 3675201)