Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 320254
End position: 320283
Length: 30

DNA sequence
>NC_008699, from 320254 to 320283 (30 bp); Nocardioides sp. JS614 CGGCCGCGGCCGGGCGGGGCGGGCTGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 320191-324171	Sequence	Noca_0303 - cell division protein FtsK (Protein is coded in complementary strand; from 324171 to 320191)