Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3170635
End position: 3170664
Length: 30

DNA sequence
>NC_008699, from 3170635 to 3170664 (30 bp); Nocardioides sp. JS614 CTGCGGCGCGCGGCCGCGCGCTGCTGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3170458-3172794	Sequence	Noca_2983 - hypothetical protein (Protein is coded in complementary strand; from 3172794 to 3170458)