Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2150264
End position: 2150293
Length: 30

DNA sequence
>NC_008699, from 2150264 to 2150293 (30 bp); Nocardioides sp. JS614 GTCGTCGTCGCCGTGGTCGTCGCCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2150184-2150561	Sequence	Noca_2008 - hypothetical protein (Protein is coded in complementary strand; from 2150561 to 2150184)