Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1187597
End position: 1187626
Length: 30

DNA sequence
>NC_008699, from 1187597 to 1187626 (30 bp); Nocardioides sp. JS614 CGGGTGAGGGTGCGGGTGAGGGTGCGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1187446-1187769	Sequence	Noca_1120 - hypothetical protein (Protein is coded in complementary strand; from 1187769 to 1187446)