Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 792806
End position: 792832
Length: 27

DNA sequence
>NC_008699, from 792806 to 792832 (27 bp); Nocardioides sp. JS614 CCGTCGGGGCCGTTGGGGCCGTTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792128-792928	Sequence	Noca_0743 fliP flagellar biosynthesis protein FliP (Protein is coded in complementary strand; from 792928 to 792128)