Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4956865
End position: 4956891
Length: 27

DNA sequence
>NC_008699, from 4956865 to 4956891 (27 bp); Nocardioides sp. JS614 CTTCTCGGCCTTGTCGGCCTGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4955357-4957693	Sequence	Noca_4676 - glycosyl transferase family protein (Protein is coded in complementary strand; from 4957693 to 4955357)