Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4875343
End position: 4875369
Length: 27

DNA sequence
>NC_008699, from 4875343 to 4875369 (27 bp); Nocardioides sp. JS614 GGGCCGCCGTGGCCGCCGGGGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4875022-4876791	Sequence	Noca_4601 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 4876791 to 4875022)