Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4855996
End position: 4856022
Length: 27

DNA sequence
>NC_008699, from 4855996 to 4856022 (27 bp); Nocardioides sp. JS614 GCCCTGGTTGCCCTGCTTGCCCTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4855295-4856287	Sequence	Noca_4585 - hypothetical protein (Protein is coded in complementary strand; from 4856287 to 4855295)