Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 43090
End position: 43116
Length: 27

DNA sequence
>NC_008699, from 43090 to 43116 (27 bp); Nocardioides sp. JS614 CGGTCTCGGTGGTCTCGGTGGTCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 41511-43124	Sequence	Noca_0037 - aldehyde dehydrogenase (Protein is coded in complementary strand; from 43124 to 41511)