Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4281458
End position: 4281484
Length: 27

DNA sequence
>NC_008699, from 4281458 to 4281484 (27 bp); Nocardioides sp. JS614 GCCACCACCGCCACCGCCGCCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4279731-4282463	Sequence	Noca_4057 - hypothetical protein (Protein is coded in complementary strand; from 4282463 to 4279731)