Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4237451
End position: 4237477
Length: 27

DNA sequence
>NC_008699, from 4237451 to 4237477 (27 bp); Nocardioides sp. JS614 CGCCTCCGTCGCCGCCGTCTCCTCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4236331-4238016	Sequence	Noca_4014 - hypothetical protein (Protein is coded in complementary strand; from 4238016 to 4236331)