Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3532813
End position: 3532839
Length: 27

DNA sequence
>NC_008699, from 3532813 to 3532839 (27 bp); Nocardioides sp. JS614 TCAGCCGGGTCAGCCGGGTCAGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3532686-3532991	Sequence	Noca_3324 - hypothetical protein (Protein is coded in complementary strand; from 3532991 to 3532686)