Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3459913
End position: 3459939
Length: 27

DNA sequence
>NC_008699, from 3459913 to 3459939 (27 bp); Nocardioides sp. JS614 CCTCGGCGGCCTCGGCCGCCTCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3459882-3461279	Sequence	Noca_3260 - 30S ribosomal protein S16 (Protein is coded in complementary strand; from 3461279 to 3459882)